Coding
Part:BBa_K129005:Design
Designed by: Burak YILMAZ Group: iGEM08_METU_Turkey (2008-11-08)
LamB_CP-metal binding domain in LamB-153 residue
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal prefix found in sequence at 1
Illegal suffix found in sequence at 1325 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1
Illegal SpeI site found at 1326
Illegal PstI site found at 1340
Illegal NotI site found at 7
Illegal NotI site found at 1333 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1
- 23INCOMPATIBLE WITH RFC[23]Illegal prefix found in sequence at 1
Illegal suffix found in sequence at 1326 - 25INCOMPATIBLE WITH RFC[25]Illegal prefix found in sequence at 1
Illegal XbaI site found at 16
Illegal SpeI site found at 1326
Illegal PstI site found at 1340
Illegal AgeI site found at 98
Illegal AgeI site found at 1202 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
To make HP_LamB GATCCAGCTGGTCATCATCCACACGGTGCT is inserted in LamB protein at 153
Source
GATCCAGCAGGCTGCGGTTGTCCATGCGGTTGTGGCGCT encodes the N-Ala-Gly-Cys-Gly-Cys-Pro-Cys-Gly-Cys-Gly-Ala-C sequence inserted in LamB-153 residue because permissive loop (between structural codons 153and 154) can be exposed to the external medium without a loss of function.